ENSDARG00000086847

Ensembl ID:
ENSDARG00000086847
Mouse Orthologues:
9930111J21Rik1, 9930111J21Rik2, Ifi47, Irgc1
Mouse Descriptions:
immunity-related GTPase family, cinema 1 Gene [Source:MGI Symbol;Acc:MGI:2685948]
interferon gamma inducible protein 47 Gene [Source:MGI Symbol;Acc:MGI:99448]
RIKEN cDNA 9930111J21 gene 1 Gene [Source:MGI Symbol;Acc:MGI:3041173]
RIKEN cDNA 9930111J21 gene 2 Gene [Source:MGI Symbol;Acc:MGI:3711310]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36139 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36139
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115303 Essential Splice Site 11 464 1 4
Genomic Location (Zv9):
Chromosome 16 (position 28045886)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25891573
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGATTTCGTGTAAACAATGAAGCACAGCGGCAGCGTGATGGATAATGGG[T/C]GAGTGGATTTTCATAGCAGGAAATTACTTTACTGTAACGTTACAAATATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link