
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
LOC559362
- Ensembl ID:
- ENSDARG00000086840
- Human Orthologues:
- RP1-130H16.18, TBC1D10A, TBC1D10B, TBC1D10C
- Human Descriptions:
- TBC1 domain family, member 10A [Source:HGNC Symbol;Acc:23609]
- TBC1 domain family, member 10B [Source:HGNC Symbol;Acc:24510]
- TBC1 domain family, member 10C [Source:HGNC Symbol;Acc:24702]
- Mouse Orthologues:
- Tbc1d10a, Tbc1d10b, Tbc1d10c
- Mouse Descriptions:
- TBC1 domain family, member 10a Gene [Source:MGI Symbol;Acc:MGI:2144164]
- TBC1 domain family, member 10b Gene [Source:MGI Symbol;Acc:MGI:1915699]
- TBC1 domain family, member 10c Gene [Source:MGI Symbol;Acc:MGI:1922072]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa32523 | Nonsense | Available for shipment | Available now |
sa10061 | Nonsense | Available for shipment | Available now |
sa32522 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa32523
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000125836 | Nonsense | 413 | 617 | 11 | 15 |
- Genomic Location (Zv9):
- Chromosome 25 (position 16850919)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 16397463 GRCz11 25 16493863 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGCGAATAAAGAAAACACAAAAATCAGTACAGCTTCTTTCAGCGATGGA[C/T]AGCTGCACGATGAAAAACCTTTGCAAGAAACTGCCAAGAAAGGTGAGCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10061
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000125836 | Nonsense | 417 | 617 | 11 | 15 |
- Genomic Location (Zv9):
- Chromosome 25 (position 16850907)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 16397451 GRCz11 25 16493851 - KASP Assay ID:
- 2261-9509.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAAACACAAAAATCAGTACAGCTTCTYTCRGCGATGGACAGCTGCACGAT[G/T]AAAAMCCTTTGCAAGAAACTGCCAAGAAAGGTRAGCCAGTTCATAGAGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32522
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000125836 | Nonsense | 546 | 617 | 14 | 15 |
- Genomic Location (Zv9):
- Chromosome 25 (position 16838304)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 16384848 GRCz11 25 16481248 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCGTGAGGTCAGGGCCTGTCGGTAAAGTGGCCCGAAGAAGGAGCCGAGAT[C/T]AATCCAGAAGAGGAAGTTCCTTCCATTCGAGGAGTCGGCGCTCTAGATCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: