LOC559362

Ensembl ID:
ENSDARG00000086840
Human Orthologues:
RP1-130H16.18, TBC1D10A, TBC1D10B, TBC1D10C
Human Descriptions:
TBC1 domain family, member 10A [Source:HGNC Symbol;Acc:23609]
TBC1 domain family, member 10B [Source:HGNC Symbol;Acc:24510]
TBC1 domain family, member 10C [Source:HGNC Symbol;Acc:24702]
Mouse Orthologues:
Tbc1d10a, Tbc1d10b, Tbc1d10c
Mouse Descriptions:
TBC1 domain family, member 10a Gene [Source:MGI Symbol;Acc:MGI:2144164]
TBC1 domain family, member 10b Gene [Source:MGI Symbol;Acc:MGI:1915699]
TBC1 domain family, member 10c Gene [Source:MGI Symbol;Acc:MGI:1922072]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32523 Nonsense Available for shipment Available now
sa10061 Nonsense Available for shipment Available now
sa32522 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32523
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125836 Nonsense 413 617 11 15
Genomic Location (Zv9):
Chromosome 25 (position 16850919)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16397463
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCGAATAAAGAAAACACAAAAATCAGTACAGCTTCTTTCAGCGATGGA[C/T]AGCTGCACGATGAAAAACCTTTGCAAGAAACTGCCAAGAAAGGTGAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10061
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125836 Nonsense 417 617 11 15
Genomic Location (Zv9):
Chromosome 25 (position 16850907)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16397451
KASP Assay ID:
2261-9509.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACACAAAAATCAGTACAGCTTCTYTCRGCGATGGACAGCTGCACGAT[G/T]AAAAMCCTTTGCAAGAAACTGCCAAGAAAGGTRAGCCAGTTCATAGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32522
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125836 Nonsense 546 617 14 15
Genomic Location (Zv9):
Chromosome 25 (position 16838304)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16384848
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTGAGGTCAGGGCCTGTCGGTAAAGTGGCCCGAAGAAGGAGCCGAGAT[C/T]AATCCAGAAGAGGAAGTTCCTTCCATTCGAGGAGTCGGCGCTCTAGATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link