ENSDARG00000086831

Ensembl ID:
ENSDARG00000086831
Human Orthologues:
ZFP62, ZNF268, ZNF585A, ZNF585B, ZNF624
Human Descriptions:
zinc finger protein 268 [Source:HGNC Symbol;Acc:13061]
zinc finger protein 585A [Source:HGNC Symbol;Acc:26305]
zinc finger protein 585B [Source:HGNC Symbol;Acc:30948]
zinc finger protein 62 homolog (mouse) [Source:HGNC Symbol;Acc:23241]
zinc finger protein 624 [Source:HGNC Symbol;Acc:29254]
Mouse Orthologues:
5430403G16Rik, Gm13212, Gm14124, Gm14295, Zfp26, Zfp27, Zfp619, Zfp62, Zfp658, Zfp788, Zfp808, Zfp873
Mouse Descriptions:
predicted gene 13212 Gene [Source:MGI Symbol;Acc:MGI:3651014]
predicted gene 14124 Gene [Source:MGI Symbol;Acc:MGI:3652002]
predicted gene 14295 Gene [Source:MGI Symbol;Acc:MGI:3709624]
RIKEN cDNA 5430403G16 gene Gene [Source:MGI Symbol;Acc:MGI:1924450]
zinc finger protein 26 Gene [Source:MGI Symbol;Acc:MGI:99173]
zinc finger protein 27 Gene [Source:MGI Symbol;Acc:MGI:99174]
zinc finger protein 619 Gene [Source:MGI Symbol;Acc:MGI:1917477]
zinc finger protein 62 Gene [Source:MGI Symbol;Acc:MGI:99662]
zinc finger protein 658 Gene [Source:MGI Symbol;Acc:MGI:2652821]
zinc finger protein 788 Gene [Source:MGI Symbol;Acc:MGI:1914857]
zinc finger protein 80 Gene [Source:MGI Symbol;Acc:MGI:3704127]
zinc finger protein 873 Gene [Source:MGI Symbol;Acc:MGI:3040689]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19946 Nonsense Mutation detected in F1 DNA During 2016
sa39986 Nonsense Mutation detected in F1 DNA During 2016
sa39987 Nonsense Mutation detected in F1 DNA During 2016
sa25991 Nonsense Mutation detected in F1 DNA During 2016
sa33089 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19946
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127809 Nonsense 226 862 1 4
Genomic Location:
Chromosome 3 (position 7582671)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAACCATTCAGATGCACTCAGTGTGGGAAGAGTTTCGGTCGATCATCA[C/T]AGCATGATATACACATGAAGAGCCACACTGGTGTGAGAGAGTATGTTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127809 Nonsense 259 862 1 4
Genomic Location:
Chromosome 3 (position 7582770)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTGAGTGTGAGAAAACCTTTATTACATCTGGAGAGTTGAAACTGCAC[C/T]AGAGGAATCACGCTGGGGAGAAACCGTACAAGTGTTCACACTGCGACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39987
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127809 Nonsense 311 862 1 4
Genomic Location:
Chromosome 3 (position 7582927)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGTACATGTGTTCACACTGCAACAAGAGATTCAGTCAGTTACCACATT[T/A]GAAAACACATGAGAGGATTCACACTGGAGAGAAACCGTACAGATGTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25991
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127809 Nonsense 520 862 2 4
Genomic Location:
Chromosome 3 (position 7602402)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGGAAACCAGAAAATACATGAGAGGATTCACACTGGAGAGAGACCGTA[T/G]AAGTGTTCACACTGCGGCATGAGATTCGGTCAGTTATCAAATCTGAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127809 Nonsense 733 862 4 4
Genomic Location:
Chromosome 3 (position 7616145)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAAACCATACAAGTGTTCACACTGCGACAAAAGATTCGGTCGGTTAT[C/A]AAATATGAAAATACATGAGAGGATTCACACTGGAGAGAAACCTTATACCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link