ENSDARG00000086830

Ensembl ID:
ENSDARG00000086830
Human Orthologue:
NLRC5
Human Description:
NLR family, CARD domain containing 5 [Source:HGNC Symbol;Acc:29933]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30438 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30438
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098235 Nonsense 239 251 3 3
Genomic Location (Zv9):
Chromosome Zv9_NA637 (position 4153)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150429.1 4153
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGCCTCATCCACTCAGTCCAGACCACATTCACTGAGCCGCTCTATCCT[G/T]GAATTACTGTTTGGTGTCAATCATCAGTCAAACTGTGCTGAAGACTGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)
  • Schizophrenia: Genome-wide association study of clinical dimensions of schizophrenia: polygenic effect on disorganized symptoms. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link