NP_001103184.1

Ensembl ID:
ENSDARG00000086810
Description:
DNA mismatch repair protein Msh3 [Source:RefSeq peptide;Acc:NP_001103184]
Human Orthologue:
MSH3
Human Description:
mutS homolog 3 (E. coli) [Source:HGNC Symbol;Acc:7326]
Mouse Orthologue:
Msh3
Mouse Description:
mutS homolog 3 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:109519]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20529 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20529
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130210 Nonsense 1064 1083 23 23
ENSDART00000140414   None 131 None 3
Genomic Location (Zv9):
Chromosome 5 (position 53307394)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50788984
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGCTCTCGTGAACAGCCGGAGGTACGTGGGCAGATTGGTTACACAATG[G/A]AAGAAGAACACTGTAGTAATTTTGTATTGTGGAGGAACTTCGTTCAGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link