ENSDARG00000086802

Ensembl ID:
ENSDARG00000086802
Human Orthologue:
TCERG1
Human Description:
transcription elongation regulator 1 [Source:HGNC Symbol;Acc:15630]
Mouse Orthologue:
Tcerg1
Mouse Description:
transcription elongation regulator 1 (CA150) Gene [Source:MGI Symbol;Acc:MGI:1926421]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28008 Nonsense Mutation detected in F1 DNA Unknown

Mutation Details

Allele Name:
sa28008
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127422 Nonsense 116 275 2 4
Genomic Location (Zv9):
Chromosome 12 (position 43880182)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 41461463
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCAGCCTTCTGCTAGTGTGGATCTGCTTCCGGTGTTTCCTCATGTGTA[T/A]CGGACAATCCTGCCACCGCACTACAGCAAAGGCTGGGTGGAAAAGCGACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link