ENSDARG00000086800

Ensembl ID:
ENSDARG00000086800
Human Orthologue:
ZBED1
Human Description:
zinc finger, BED-type containing 1 [Source:HGNC Symbol;Acc:447]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32554 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32554
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040430 Nonsense 14 485 1 4
Genomic Location (Zv9):
Chromosome Zv9_scaffold3503 (position 756459)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 46422934
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGATTGAAAAGTCGTAGATCCACGTTACGAAATACCCAGCCGCAAATA[T/A]TTTTCCTCCACTGCCATTCCACAGCTTTATTCAGAGTGTCGCAGCAAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link