TTF2

Ensembl ID:
ENSDARG00000086795
Description:
transcription termination factor, RNA polymerase II [Source:HGNC Symbol;Acc:12398]
Human Orthologue:
TTF2
Human Description:
transcription termination factor, RNA polymerase II [Source:HGNC Symbol;Acc:12398]
Mouse Orthologue:
Ttf2
Mouse Description:
transcription termination factor, RNA polymerase II Gene [Source:MGI Symbol;Acc:MGI:1921294]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16912 Nonsense Available for shipment Available now
sa41360 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126063 Nonsense 274 1149 5 25
Genomic Location (Zv9):
Chromosome 9 (position 10154902)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9959077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCTAGAAAAACCKSCGGCTCTGCACAAAGCCCTTCAAAAAGCTCACCT[G/T]GACTTGACAAGAAAACCTCAAACAAGCAAAGCAMTTCTAATTCAAAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41360
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126063 Essential Splice Site 998 1149 22 25
Genomic Location (Zv9):
Chromosome 9 (position 10172730)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9976678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAATGCTTGAGATTCTCTGAGTGGGTTTTTGTAATTTCTTGTTTGGCA[G/A]TGTGATTGTGTCTCAGTGGACCAGCATGCTGAAAATTGTTGCCGTTCACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link