TTF2

Ensembl ID:
ENSDARG00000086795
Description:
transcription termination factor, RNA polymerase II [Source:HGNC Symbol;Acc:12398]
Human Orthologue:
TTF2
Human Description:
transcription termination factor, RNA polymerase II [Source:HGNC Symbol;Acc:12398]
Mouse Orthologue:
Ttf2
Mouse Description:
transcription termination factor, RNA polymerase II Gene [Source:MGI Symbol;Acc:MGI:1921294]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8332 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16912 Nonsense Available for shipment Available now
sa5523 Nonsense Mutation detected in F1 DNA During 2016
sa41360 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa8332
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126063 Essential Splice Site 47 1149 2 25
Genomic Location:
Chromosome 9 (position 10152492)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCACTGCGCGTGATGCAACGCCSTGCAATTTTACACTGCCTACACAG[T/C]GAGTATACACACATTTAGATAGACATGATAATAACATCATCCTAATTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126063 Nonsense 274 1149 5 25
Genomic Location:
Chromosome 9 (position 10154902)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCTAGAAAAACCKSCGGCTCTGCACAAAGCCCTTCAAAAAGCTCACCT[G/T]GACTTGACAAGAAAACCTCAAACAAGCAAAGCAMTTCTAATTCAAAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5523
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126063 Nonsense 829 1149 15 25
Genomic Location:
Chromosome 9 (position 10167578)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCTATGTCAGGTGTCTCTGCCTGATCGGACATGTGAGATTCACCGTT[T/A]GAAACTGTCTGAAGATGAGCAGGCTGTATATGATGTTGTGTTTGCACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41360
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126063 Essential Splice Site 998 1149 22 25
Genomic Location:
Chromosome 9 (position 10172730)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAATGCTTGAGATTCTCTGAGTGGGTTTTTGTAATTTCTTGTTTGGCA[G/A]TGTGATTGTGTCTCAGTGGACCAGCATGCTGAAAATTGTTGCCGTTCACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link