si:ch73-34b5.3

Ensembl ID:
ENSDARG00000086790
ZFIN ID:
ZDB-GENE-090313-160
Description:
Soluble guanylyl cyclase beta1 subunit [Source:UniProtKB/TrEMBL;Acc:D1LXJ3]
Human Orthologue:
GUCY1B3
Human Description:
guanylate cyclase 1, soluble, beta 3 [Source:HGNC Symbol;Acc:4687]
Mouse Orthologue:
Gucy1b3
Mouse Description:
guanylate cyclase 1, soluble, beta 3 Gene [Source:MGI Symbol;Acc:MGI:1860604]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16873 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16873
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129471 Essential Splice Site 242 608 6 13

The following transcripts of ENSDARG00000086790 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 24668887)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25120658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTCATGCTAACACAGTGTGGCAACGCCATCTTCAGAGTCTTGCCACAG[G/A]TTTGTCTATTCAAAAATAAATTTTGCCCAGCTATTAAGTGACTTTTGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link