LOC564712

Ensembl ID:
ENSDARG00000086789
Human Orthologue:
BAHD1
Human Description:
bromo adjacent homology domain containing 1 [Source:HGNC Symbol;Acc:29153]
Mouse Orthologue:
Bahd1
Mouse Description:
bromo adjacent homology domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2139371]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7833 Nonsense Mutation detected in F1 DNA During 2016
sa11391 Nonsense Available for shipment Available now
sa36454 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa7833
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124505 Nonsense 211 812 1 6
Genomic Location:
Chromosome 17 (position 31356882)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCCAGAAAAAGCCAAGACAACAGAAAACGRGGATGTACCGGAGAGACC[G/T]AACMAAACCGGAATCCCAAAAAAGCRAAGACAGAAAGCGACACTATTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11391
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124505 Nonsense 314 812 1 6
Genomic Location:
Chromosome 17 (position 31356572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCAGTGCTGCAGCTTCTGTGAGAAGCATGCTCTACACAATGAGGCAT[T/A]ATGGGATGGGAGCACAGGAAGCCATGGCTTTATTAGCCCAGGATATCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36454
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124505 Nonsense 329 812 1 6
Genomic Location:
Chromosome 17 (position 31356526)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTATGGGATGGGAGCACAGGAAGCCATGGCTTTATTAGCCCAGGATA[T/A]CAGTGCAGATCCATGCTCGGCTTTCCCCTGAAGCCTGTGAAGGAAGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link