LOC564712

Ensembl ID:
ENSDARG00000086789
Human Orthologue:
BAHD1
Human Description:
bromo adjacent homology domain containing 1 [Source:HGNC Symbol;Acc:29153]
Mouse Orthologue:
Bahd1
Mouse Description:
bromo adjacent homology domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2139371]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11391 Nonsense Available for shipment Available now
sa36454 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11391
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124505 Nonsense 314 812 1 6
Genomic Location (Zv9):
Chromosome 17 (position 31356572)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31280499
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCAGTGCTGCAGCTTCTGTGAGAAGCATGCTCTACACAATGAGGCAT[T/A]ATGGGATGGGAGCACAGGAAGCCATGGCTTTATTAGCCCAGGATATCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36454
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124505 Nonsense 329 812 1 6
Genomic Location (Zv9):
Chromosome 17 (position 31356526)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31280453
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTATGGGATGGGAGCACAGGAAGCCATGGCTTTATTAGCCCAGGATA[T/A]CAGTGCAGATCCATGCTCGGCTTTCCCCTGAAGCCTGTGAAGGAAGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link