LOC100330293

Ensembl ID:
ENSDARG00000086776
Human Orthologue:
GPR35
Human Description:
G protein-coupled receptor 35 [Source:HGNC Symbol;Acc:4492]
Mouse Orthologue:
Gpr35
Mouse Description:
G protein-coupled receptor 35 Gene [Source:MGI Symbol;Acc:MGI:1929509]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43755 Nonsense Mutation detected in F1 DNA During 2016
sa37417 Nonsense Mutation detected in F1 DNA During 2016
sa14229 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43755
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126730 Nonsense 75 296 3 3
Genomic Location (Zv9):
Chromosome 22 (position 3224625)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 3217330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCAACATGGCGGTGGCGGACTGCGTGATGCTCGTCATCCTCCCCATA[C/T]GAATAATGTCTATCTACGAAAACACACTCGTTTCCAGATTCTGGGACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37417
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126730 Nonsense 268 296 3 3
Genomic Location (Zv9):
Chromosome 22 (position 3224044)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 3216749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAAGTACATCACTCAGGCGCACAAATACAGCTGCGACGCACAGATTTG[G/A]TCGCATAATTTCGTTCATGCCGCCATCTGTGTTTCTAGCATGAATTGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14229
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126730 Nonsense 278 296 3 3
Genomic Location (Zv9):
Chromosome 22 (position 3224014)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 3216719
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGCGACGCACAGATTTGGTCGCATAATTTCGTYCRTGCCGCCATCTG[T/A]GTTTCTAGCATGAATTGCGCACTCGATTGTGTCACTTATTACTTYGCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link