LOC100330293

Ensembl ID:
ENSDARG00000086776
Human Orthologue:
GPR35
Human Description:
G protein-coupled receptor 35 [Source:HGNC Symbol;Acc:4492]
Mouse Orthologue:
Gpr35
Mouse Description:
G protein-coupled receptor 35 Gene [Source:MGI Symbol;Acc:MGI:1929509]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14229 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14229
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126730 Nonsense 278 296 3 3
Genomic Location:
Chromosome 22 (position 3224014)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGCGACGCACAGATTTGGTCGCATAATTTCGTYCRTGCCGCCATCTG[T/A]GTTTCTAGCATGAATTGCGCACTCGATTGTGTCACTTATTACTTYGCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8cvl1o3x