im:7145391

Ensembl ID:
ENSDARG00000086747
ZFIN IDs:
ZDB-GENE-030131-8820, ZDB-GENE-041111-237
Description:
Toll-interacting protein [Source:UniProtKB/Swiss-Prot;Acc:Q7ZV43]
Human Orthologue:
TOLLIP
Human Description:
toll interacting protein [Source:HGNC Symbol;Acc:16476]
Mouse Orthologue:
Tollip
Mouse Description:
toll interacting protein Gene [Source:MGI Symbol;Acc:MGI:1891808]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12341 Nonsense Available for shipment Available now
sa7111 Nonsense Mutation detected in F1 DNA During 2014
sa21153 Nonsense Mutation detected in F1 DNA During 2014
sa968 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12341
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126917 Nonsense 116 276 3 6
Genomic Location:
Chromosome 7 (position 74852239)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAACAAAGTCATCCAGTGCACYGTCCCTCCCGGGGTGGACTCCTTCTA[T/A]CTGGAGATATTCGATGAGGTCAGACTTCAATAMTCAATATAHAGACYTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7111
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126917 Nonsense 116 276 3 6
Genomic Location:
Chromosome 7 (position 74852239)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAACAAAGTCATCCAGTGCACCGTCCCTCCCGGGGTGGACTCCTTCTA[T/A]CTGGAGATATTCGATGAGGTCAGACTTCAATAMTCAATATATAGACYTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21153
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126917 Nonsense 152 276 4 6
ENSDART00000126917 Nonsense 152 276 4 6
Genomic Location:
Chromosome 7 (position 74854945)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCACAATCCCTGAAAACCTGCGGGAGGGAACTGTAGTGGACGAGTGGTA[C/A]AGCCTGAGCGGGAGACAGGGGGACGACAAAGAGGGCATGATTAATCTCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa968
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126917 Nonsense 152 276 4 6
ENSDART00000126917 Nonsense 152 276 4 6
Genomic Location:
Chromosome 7 (position 74854945)
KASP Assay ID:
554-0873.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCACAATCCCTGAAAACCTGCGGGAGGGAACTGTAGTGGACGAGTGGTA[C/G]AGCCTGAGCRGGAGACAGGGGGACGACAAAGAGGGCATGATTAATCTCGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jfh7rqdh