tmem68

Ensembl ID:
ENSDARG00000086737
ZFIN ID:
ZDB-GENE-040426-1267
Description:
transmembrane protein 68 [Source:RefSeq peptide;Acc:NP_956786]
Human Orthologue:
TMEM68
Human Description:
transmembrane protein 68 [Source:HGNC Symbol;Acc:26510]
Mouse Orthologue:
Tmem68
Mouse Description:
transmembrane protein 68 Gene [Source:MGI Symbol;Acc:MGI:1919348]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7499 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7499
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126762 Missense 59 166 1 2
Genomic Location:
Chromosome 2 (position 27803546)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATCTGGTCTGGGTTTTCACACCGCTAGTCGTGGTCTTCATCCTGCCCT[T/C]TCTCATAGTGATTCTTCTCTATCTGTCAATACTTTTCCTCCATGTGTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i4yd5a79