ENSDARG00000086721

Ensembl ID:
ENSDARG00000086721
Human Orthologues:
CD101, IGSF3, IGSF8, PTGFRN
Human Descriptions:
CD101 molecule [Source:HGNC Symbol;Acc:5949]
immunoglobulin superfamily, member 3 [Source:HGNC Symbol;Acc:5950]
immunoglobulin superfamily, member 8 [Source:HGNC Symbol;Acc:17813]
prostaglandin F2 receptor negative regulator [Source:HGNC Symbol;Acc:9601]
Mouse Orthologues:
Cd101, Igsf3, Igsf8, Ptgfrn
Mouse Descriptions:
CD101 antigen Gene [Source:MGI Symbol;Acc:MGI:2685862]
immunoglobulin superfamily, member 3 Gene [Source:MGI Symbol;Acc:MGI:1926158]
immunoglobulin superfamily, member 8 Gene [Source:MGI Symbol;Acc:MGI:2154090]
prostaglandin F2 receptor negative regulator Gene [Source:MGI Symbol;Acc:MGI:1277114]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13976 Nonsense Available for shipment Available now
sa27307 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa13976
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127352 Nonsense 252 1399 3 11
Genomic Location:
Chromosome 9 (position 523528)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGAAGATKCCTCAAGTGCAGCAGTCAGACCAGGGGAAGTTCTACTGC[A/T]AAAYCGTCMAGTGGATCCAAGACCCAGATCGWAACTGGACAGAGATTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127352 Nonsense 536 1399 5 11
Genomic Location:
Chromosome 9 (position 524989)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCATACAGAGCAATGGCGAGATGAAGAAAACACACACCCAGTCTCAG[C/T]AAAATAAAGTTGCAGTGCGTTCAGTTGGTAAGACTACACACACACACTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n8a1nx52