ENSDARG00000086721

Ensembl ID:
ENSDARG00000086721
Human Orthologues:
CD101, IGSF3, IGSF8, PTGFRN
Human Descriptions:
CD101 molecule [Source:HGNC Symbol;Acc:5949]
immunoglobulin superfamily, member 3 [Source:HGNC Symbol;Acc:5950]
immunoglobulin superfamily, member 8 [Source:HGNC Symbol;Acc:17813]
prostaglandin F2 receptor negative regulator [Source:HGNC Symbol;Acc:9601]
Mouse Orthologues:
Cd101, Igsf3, Igsf8, Ptgfrn
Mouse Descriptions:
CD101 antigen Gene [Source:MGI Symbol;Acc:MGI:2685862]
immunoglobulin superfamily, member 3 Gene [Source:MGI Symbol;Acc:MGI:1926158]
immunoglobulin superfamily, member 8 Gene [Source:MGI Symbol;Acc:MGI:2154090]
prostaglandin F2 receptor negative regulator Gene [Source:MGI Symbol;Acc:MGI:1277114]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34537 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13976 Nonsense Available for shipment Available now
sa41326 Nonsense Mutation detected in F1 DNA During 2016
sa27307 Nonsense Mutation detected in F1 DNA During 2016
sa34538 Nonsense Mutation detected in F1 DNA During 2016
sa41327 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34537
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127352 Essential Splice Site 144 1399 2 11
Genomic Location (Zv9):
Chromosome 9 (position 522594)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 538053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGATCCCAGATTGTTTGGAGTATATGAAGCAGAAACAACACTTAACGG[T/A]AAGATATTTATTTAAGTTTGACTTTATTCAATGGCATCTCCCATCTAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13976
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127352 Nonsense 252 1399 3 11
Genomic Location (Zv9):
Chromosome 9 (position 523528)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 538987
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGAAGATKCCTCAAGTGCAGCAGTCAGACCAGGGGAAGTTCTACTGC[A/T]AAAYCGTCMAGTGGATCCAAGACCCAGATCGWAACTGGACAGAGATTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41326
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127352 Nonsense 404 1399 4 11
Genomic Location (Zv9):
Chromosome 9 (position 524456)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 539915
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGGCAGGAGAGCATGAATGAAGACGGCACCTTCAAAAGAGTGCAAAAA[C/T]AACTGTCCAACCCTGAGACTGTGAACATCACGACTAAAGGTAATTGCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127352 Nonsense 536 1399 5 11
Genomic Location (Zv9):
Chromosome 9 (position 524989)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 452756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCATACAGAGCAATGGCGAGATGAAGAAAACACACACCCAGTCTCAG[C/T]AAAATAAAGTTGCAGTGCGTTCAGTTGGTAAGACTACACACACACACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34538
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127352 Nonsense 667 1399 6 11
Genomic Location (Zv9):
Chromosome 9 (position 525528)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 540987
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGTAGACAGAAAGCCATAAAGAACTCCAACTTACTAGCAGTGACTATA[C/T]AAAAACCTGGTAAATACAGCTGTATATGTTGATGTATTTATAAAGTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41327
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127352 Nonsense 889 1399 8 11
Genomic Location (Zv9):
Chromosome 9 (position 528936)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 544282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTCCATTTCTTCAGTCCAGCGGTGGGTATCTTCCAATTGACCATCCAT[A/T]GAGCCATTCAGACAGACAGGGGGCGCTACCACTGTCAAGCTCAACAGTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link