ENSDARG00000086705

Ensembl ID:
ENSDARG00000086705
Human Orthologue:
AC135457.1
Mouse Orthologue:
Gm1614
Mouse Description:
predicted gene 1614 Gene [Source:MGI Symbol;Acc:MGI:2686460]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23967 Nonsense Available for shipment Available now
sa11105 Nonsense Available for shipment Available now
sa23968 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23967
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128078 Nonsense 214 1259 1 1
Genomic Location:
Chromosome 21 (position 28830792)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAACCCGGATTCACTTCAAACACTATTTTGATAACGCCTGACAGAAAT[C/T]AATACAGCAAGGGTCGGGAACAGGAGCATGGTGGCACAGAGCCAAAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11105
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128078 Nonsense 597 1259 1 1
Genomic Location:
Chromosome 21 (position 28831943)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATTTGCWTCAACCAAAGTGAACATCWGAACTGCTACAACTGATGAATG[T/A]TTGTATGTGTCTGGYAAGGATGTATATGCTGAAACTACAAAAACATATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23968
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128078 Nonsense 1058 1259 1 1
Genomic Location:
Chromosome 21 (position 28833326)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCTTGTGTCCTAACAGTAGCTTCAACTCCTATGGTTCCTTCCTATTA[T/G]TACAAACCCAATGTACTGGGTTACCAAACAGTCTCTCCTCATATTGGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/24f1wlip