dnajc12

Ensembl ID:
ENSDARG00000086691
ZFIN ID:
ZDB-GENE-070801-3
Human Orthologue:
DNAJC12
Human Description:
DnaJ (Hsp40) homolog, subfamily C, member 12 [Source:HGNC Symbol;Acc:28908]
Mouse Orthologue:
Dnajc12
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 12 Gene [Source:MGI Symbol;Acc:MGI:1353428]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15201 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15201
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127610 Essential Splice Site 139 188 4 7
Genomic Location (Zv9):
Chromosome 13 (position 51347966)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50059063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGAAAACACAGTGCAGGAGAAACCATCTGARGCATCACTGCCATCAAG[T/C]AGGAGAYTTGTGTTTACTCTWAGATGTTATCGTTTGTTTCACTCTTAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link