KIAA0146

Ensembl ID:
ENSDARG00000086681
Description:
KIAA0146 [Source:HGNC Symbol;Acc:28971]
Human Orthologue:
KIAA0146
Human Description:
KIAA0146 [Source:HGNC Symbol;Acc:28971]
Mouse Orthologue:
2310008H04Rik
Mouse Description:
RIKEN cDNA 2310008H04 gene Gene [Source:MGI Symbol;Acc:MGI:1924834]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37937 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37938 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37937
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130705 Essential Splice Site 162 539 5 11
ENSDART00000130705 Essential Splice Site 162 539 5 11
Genomic Location (Zv9):
Chromosome 24 (position 37164500)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35781760
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGAATTCAGCTTCCAAAGAGCACAGTGACTTCCTAAATCCTGCTGTGG[T/A]AAGTGTGTTTTAAAGTTTAATATCGGCCGAAGCATCTCATAAGTGTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37938
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130705 Essential Splice Site 162 539 5 11
ENSDART00000130705 Essential Splice Site 162 539 5 11
Genomic Location (Zv9):
Chromosome 24 (position 37164500)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35781760
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGAATTCAGCTTCCAAAGAGCACAGTGACTTCCTAAATCCTGCTGTGG[T/A]AAGTGTGTTTTAAAGTTTAATATCGGCCGAAGCATCTCATAAGTGTAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link