tec

Ensembl ID:
ENSDARG00000086680
ZFIN ID:
ZDB-GENE-030131-7499
Description:
tyrosine-protein kinase Tec [Source:RefSeq peptide;Acc:NP_001108215]
Human Orthologue:
TEC
Human Description:
tec protein tyrosine kinase [Source:HGNC Symbol;Acc:11719]
Mouse Orthologue:
Tec
Mouse Description:
tec protein tyrosine kinase Gene [Source:MGI Symbol;Acc:MGI:98662]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16644 Essential Splice Site Available for shipment Available now
sa14472 Nonsense Available for shipment Available now
sa24787 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16644
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123196 Essential Splice Site 152 570 4 15
Genomic Location:
Chromosome Zv9_NA110 (position 7308)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGATAAGCTCGCACCGGGATGTGAGGGGTACAACTTAWTTGGAGATGG[T/A]AAGACAGCTTTAGAGCTTTAAAGGGATAGTTCACCTGAAAGYGAAAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14472
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123196 Nonsense 226 570 6 15
Genomic Location:
Chromosome Zv9_NA110 (position 11298)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACGGGTGAAGAGTACRTCATMCTGGAAAAGTGTGAAGTCAACTGGTA[C/A]AAGGCACGAAACAAAGAAGGGTASGTCTGAATGAAGGAATGTCCACCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24787
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123196 Essential Splice Site 300 570 10 15
Genomic Location:
Chromosome Zv9_NA110 (position 15887)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGTGATGTGATGCGGATGGTGTGTGTTGATTGTGATGTTGTGGTTTTC[A/T]GTGACGGAGCAGCAGCGATCCGACATTACCAGATTAAAGAAATACACGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i1sczxpr