si:ch211-197l9.5

Ensembl ID:
ENSDARG00000086679
ZFIN ID:
ZDB-GENE-091204-323
Human Orthologue:
HUNK
Human Description:
hormonally up-regulated Neu-associated kinase [Source:HGNC Symbol;Acc:13326]
Mouse Orthologues:
CU041227.2, Hunk
Mouse Description:
hormonally upregulated Neu-associated kinase Gene [Source:MGI Symbol;Acc:MGI:1347352]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32452 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32452
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126586 Essential Splice Site 144 493 None 6
ENSDART00000145598   382 382 None 7
Genomic Location (Zv9):
Chromosome 23 (position 31279635)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31114525
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCTGAAAAAACTGACCAGGCATCAGAAAGTAGTGCGGAGCATGAAGG[T/A]AAAATAACAGCTAAATGGACAAACATGCATTCAAGTGTTTTCTATTTTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 2 diabetes: Transferability of type 2 diabetes implicated loci in multi-ethnic cohorts from Southeast Asia. (View Study)
  • Vitiligo: Genome-wide association study of generalized vitiligo in an isolated European founder population identifies SMOC2, in close proximity to IDDM8. (View Study)
  • Working memory: Genome-wide pharmacogenomic study of neurocognition as an indicator of antipsychotic treatment response in schizophrenia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link