DYNC2H1 (2 of 2)

Ensembl ID:
ENSDARG00000086671
Description:
dynein, cytoplasmic 2, heavy chain 1 [Source:HGNC Symbol;Acc:2962]
Human Orthologue:
DYNC2H1
Human Description:
dynein, cytoplasmic 2, heavy chain 1 [Source:HGNC Symbol;Acc:2962]
Mouse Orthologue:
Dync2h1
Mouse Description:
dynein cytoplasmic 2 heavy chain 1 Gene [Source:MGI Symbol;Acc:MGI:107736]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36001 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42628 Nonsense Mutation detected in F1 DNA During 2017
sa36000 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36001
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125822 Essential Splice Site 678 1076 12 18
Genomic Location (Zv9):
Chromosome 15 (position 44041486)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45022924
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGCTCAATGATTATTTCCACAGAGCTCTGGAGTGGGTTCTCAAACAG[G/A]TGCATTCCTAAAGTCCATATGAACCGGAAGTTGCTGAGACTTTTATTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42628
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125822 Nonsense 951 1076 17 18
Genomic Location (Zv9):
Chromosome 15 (position 44029333)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45010771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACACACACACTCACACACACATACTTATCTATATCTCTGCATTAGTTA[T/A]CCAGACAGAGAGCAGCTGCAGACAGTCTATAGTGCGTACCTGAAACCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36000
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125822 Nonsense 1028 1076 18 18
Genomic Location (Zv9):
Chromosome 15 (position 44027337)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45008775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTCACTCCATGTTTACTCACAGAGTGGGTCCTGAATCTGCTGCGGTA[C/A]GACCTGAGCGCAGGTGAGCTCAACACACTCAATAATTCACTAACATCTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link