narg2

Ensembl ID:
ENSDARG00000086670
ZFIN ID:
ZDB-GENE-060306-1
Human Orthologue:
NARG2
Human Description:
NMDA receptor regulated 2 [Source:HGNC Symbol;Acc:29885]
Mouse Orthologue:
Narg2
Mouse Description:
NMDA receptor-regulated gene 2 Gene [Source:MGI Symbol;Acc:MGI:2135947]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25236 Nonsense Mutation detected in F1 DNA During 2017
sa38122 Nonsense Mutation detected in F1 DNA During 2017
sa38123 Nonsense Mutation detected in F1 DNA During 2017
sa24715 Nonsense Available for shipment Available now
sa38124 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25236
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121498 Nonsense 81 929 3 16
Genomic Location (Zv9):
Chromosome 25 (position 35020982)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 33488745
KASP Assay ID:
554-7726.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAAGTTTCAGATGTTAGTAACGCCTTGGCTGCAGACGAGCCCACGGCT[G/T]AATGCAAACCAACTCAAAAAGCCAAATCTACACCTGAGAAGAACTCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38122
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121498 Nonsense 217 929 5 16
Genomic Location (Zv9):
Chromosome 25 (position 35022080)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 33489843
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGACCAGTCTAAAATTTGTGTGTACAATATCGCTCAACTTTGAGAAA[C/T]AGATTCTGGCGATGGTACTTATATTCTATATTTTGTTTTCAGCTTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38123
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121498 Nonsense 693 929 11 16
Genomic Location (Zv9):
Chromosome 25 (position 35035815)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 33503578
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTAATGGTGCGCAGCAGTGTGGACATCGCTCACCCGAAACACGACAGA[A/T]AGACCTTCAGGGTAACCCATGCACATACACATATGTTTGTATTGGTGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24715
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121498 Nonsense 853 929 15 16
Genomic Location (Zv9):
Chromosome 25 (position 35049676)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 33517439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTTCCTTTGGACCCTACGCACGTCCTGCCATTTCATCAGAAACACAAC[A/T]GACCACCCTGCACCTTCCCTCCACGTCCACCCCCTCAGGTATGACCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38124
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121498 Nonsense 874 929 16 16
Genomic Location (Zv9):
Chromosome 25 (position 35054985)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 33522748
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCTCCTTTTCTATTCTCATACAGCCAAAAGTTAAGGCGGGACCAAAG[C/T]AAAGACAGAGAAAAAAAGCTTGCAGACAACCACAAAAAAGCAACGCATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link