ENSDARG00000086642

Ensembl ID:
ENSDARG00000086642
Human Orthologue:
ATP13A3
Human Description:
ATPase type 13A3 [Source:HGNC Symbol;Acc:24113]
Mouse Orthologue:
Atp13a3
Mouse Description:
ATPase type 13A3 Gene [Source:MGI Symbol;Acc:MGI:2685387]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38194 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121609 Nonsense 171 237 4 5
Genomic Location (Zv9):
Chromosome Zv9_NA495 (position 4716)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150249.1 4716
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGGCCGTCGCCAGCGTTGTCTTTATCTACTCTCTGGTCATGAAGATCT[T/A]AAATCAGGTTTTTATCCATCATTACCTCTCTGCAGGGTTTTTAAGTGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link