ENSDARG00000086632

Ensembl ID:
ENSDARG00000086632

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25446 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25446
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064307 Nonsense 406 1020 7 12
ENSDART00000127437 Nonsense 297 959 2 9
Genomic Location:
Chromosome Zv9_scaffold3488 (position 130214)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAAAGAGTCTCTTTATTATGTGCCACATCCCAGTCTTCTGCTGGATTT[C/A]AGTCACTGTTCTCCAGAACATGCTGAAACTGAAACACAGGGCTCATGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jivbd6mq