LOC560627

Ensembl ID:
ENSDARG00000086627
Human Orthologues:
NT5C1A, NT5C1B, RP11-111J6.1
Human Descriptions:
5'-nucleotidase, cytosolic IA [Source:HGNC Symbol;Acc:17819]
5'-nucleotidase, cytosolic IB [Source:HGNC Symbol;Acc:17818]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9J2C7]
Mouse Orthologues:
Nt5c1a, Nt5c1b
Mouse Descriptions:
5'-nucleotidase, cytosolic IA Gene [Source:MGI Symbol;Acc:MGI:2155700]
5'-nucleotidase, cytosolic IB Gene [Source:MGI Symbol;Acc:MGI:1918131]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38109 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38109
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130396 Nonsense 137 272 5 6
Genomic Location (Zv9):
Chromosome 25 (position 32474056)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 30991114
GRCz10 25 31100172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGCTCATTTTGTTTTCGTCAGGGATTTCAGCCGCTCTGCTGTACGAT[C/T]AGGCTGATCATCGCGTCCTCAAGCAGCTAAAAGTGATTTTTTCAGGTGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link