ENSDARG00000086626

Ensembl ID:
ENSDARG00000086626
Human Orthologue:
ZFAT
Human Description:
zinc finger and AT hook domain containing [Source:HGNC Symbol;Acc:19899]
Mouse Orthologue:
Zfat
Mouse Description:
zinc finger and AT hook domain containing Gene [Source:MGI Symbol;Acc:MGI:2681865]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36129 Nonsense Mutation detected in F1 DNA During 2016
sa11133 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125838 Nonsense 688 1266 1 1
Genomic Location (Zv9):
Chromosome 16 (position 27309920)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25155607
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTCTTCTGAGGAAATGGAAATTGATTCGGAATCTCTTAGTGAAGGCTA[T/A]CAAGTGTTCATTACTAACAAAGGCGTGAAGCGGTATGTTTGCATCGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11133
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125838 Nonsense 744 1266 1 1
Genomic Location (Zv9):
Chromosome 16 (position 27310086)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25155773
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAGGAGCAAACTAYTGAGAATAAGATAGCTGATTTGCCTGGGCCAATT[A/T]AAAAATTTCCATGTCCTCAATGTGGCAAATTTTTCAGCCGTAAAGATAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Hypertension: Two-marker association tests yield new disease associations for coronary artery disease and hypertension. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link