CCR8 (1 of 2)

Ensembl ID:
ENSDARG00000086616
Description:
chemokine (C-C motif) receptor 8 [Source:HGNC Symbol;Acc:1609]
Human Orthologue:
CCR8
Human Description:
chemokine (C-C motif) receptor 8 [Source:HGNC Symbol;Acc:1609]
Mouse Orthologue:
Ccr8
Mouse Description:
chemokine (C-C motif) receptor 8 Gene [Source:MGI Symbol;Acc:MGI:1201402]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39080 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124693 Nonsense 117 411 4 4
Genomic Location (Zv9):
Chromosome 16 (position 10037458)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8820704
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTTGTGGTGGGCTTTCTGGGTAACGCTCTGGTTATCTGGGTGGTTT[T/A]GATGGGTGTCAAGCTGAGAAGCATGACTGATATCTGTCTCCTGAACCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link