ENSDARG00000086613

Ensembl ID:
ENSDARG00000086613

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10941 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10941
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129755 Nonsense 394 543 1 1
Genomic Location (Zv9):
Chromosome 19 (position 8579858)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 8038397
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCATATTCAATATTGATTATCTGATTTTAACCACAATCATGGCCAGGT[G/A]GCTCTGTGATCACTTGGATTTGCATTCATCAGATTACAGAAAAGACAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link