nrg2b

Ensembl ID:
ENSDARG00000086585
ZFIN ID:
ZDB-GENE-090205-2
Description:
neuregulin 2b [Source:RefSeq peptide;Acc:NP_001138563]
Human Orthologue:
NRG2
Human Description:
neuregulin 2 [Source:HGNC Symbol;Acc:7998]
Mouse Orthologue:
Nrg2
Mouse Description:
neuregulin 2 Gene [Source:MGI Symbol;Acc:MGI:1098246]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35635 Nonsense Mutation detected in F1 DNA During 2017
sa11366 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35635
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127494 Nonsense 155 599 4 11
ENSDART00000129055 Nonsense 261 697 4 10
Genomic Location (Zv9):
Chromosome 14 (position 8358739)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 8082529
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGCAATGAAACTGAGAAGACATACTGCATCAACGGTGGAGACTGTTA[T/A]TTCATACATGGTATAAATCAGCTGTCCTGCAAGTAAGTTACACATTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11366
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127494 Essential Splice Site 270 599 9 11
ENSDART00000129055 Essential Splice Site 368 697 8 10
Genomic Location (Zv9):
Chromosome 14 (position 8399147)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 8122391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTCTGAATAGNTTTTGATTTGTCATCAAGCKTTTTTSNTTTTTATTGC[A/T]GTATATATCTAAGAATGTCCCGGCAACTGAACGAGTAGTACGACATGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link