ENSDARG00000086583

Ensembl ID:
ENSDARG00000086583
Human Orthologues:
APOA1, APOA4, APOA5
Human Descriptions:
apolipoprotein A-I [Source:HGNC Symbol;Acc:600]
apolipoprotein A-IV [Source:HGNC Symbol;Acc:602]
apolipoprotein A-V [Source:HGNC Symbol;Acc:17288]
Mouse Orthologues:
Apoa1, Apoa4, Apoa5
Mouse Descriptions:
apolipoprotein A-I Gene [Source:MGI Symbol;Acc:MGI:88049]
apolipoprotein A-IV Gene [Source:MGI Symbol;Acc:MGI:88051]
apolipoprotein A-V Gene [Source:MGI Symbol;Acc:MGI:1913363]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28374 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28374
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125748 Essential Splice Site 15 257 2 3
Genomic Location (Zv9):
Chromosome 15 (position 3896)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACTGAAGAATATGTATTCTATTGATGAACTAACGATGCTTGTTGTGGC[A/C]GGTTGCCAGGCCCGGTTCCTGCAGGACGAGCCCCCATCGCAGCTGGAGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link