si:ch1073-464p5.4

Ensembl ID:
ENSDARG00000086569
ZFIN IDs:
ZDB-GENE-080219-23, ZDB-GENE-080219-23, ZDB-GENE-091111-5
Description:
hypothetical protein LOC100007431 [Source:RefSeq peptide;Acc:NP_001121771]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1685 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1685
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097293 Nonsense 173 599 5 5
ENSDART00000132460 Nonsense 197 623 5 5
Genomic Location (Zv9):
Chromosome 3 (position 1783752)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1241964
KASP Assay ID:
554-1631.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCCTCAACCCGCCAGTCCAGGTGTACCATGTATTACAGCGGAATCACA[C/T]GATACGAAGAGCTCTCGATGAACAAACTGGGCAYGATCACCTACCCTCAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link