ENSDARG00000086566

Ensembl ID:
ENSDARG00000086566
Human Orthologue:
GPR144
Human Description:
G protein-coupled receptor 144 [Source:HGNC Symbol;Acc:18651]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18623 Essential Splice Site Available for shipment Available now
sa3168 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa18623
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124937 Essential Splice Site 78 210 3 6
Genomic Location:
Chromosome 22 (position 22853815)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRTCTCTCTGTGCACTGCTGGTGACCTTGATGCTGTTTACYGTGTTGGAG[T/C]AAGTGCTTTTYACCCATAYACCGCATCATTCACCGTCTTTATCATGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3168
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124937 Nonsense 181 210 6 6
Genomic Location:
Chromosome 22 (position 22861111)
KASP Assay ID:
554-2798.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCAGTGCTGATCGTCACCATCACACTGGCCTCWGCCTCTGGGAAATA[C/A]ACTGCTGAYGGTCACTGCTGGCTCAGTGTTCAGAAYGGCGTCATATGGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6k61lu5l