sb:cb1008

Ensembl ID:
ENSDARG00000086559
ZFIN ID:
ZDB-GENE-031204-9
Human Orthologues:
CUX1, CUX2
Human Descriptions:
cut-like homeobox 1 [Source:HGNC Symbol;Acc:2557]
cut-like homeobox 2 [Source:HGNC Symbol;Acc:19347]
Mouse Orthologues:
Cux1, Cux2
Mouse Descriptions:
cut-like homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:88568]
cut-like homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:107321]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33516 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33516
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128728 Nonsense 28 643 2 11
Genomic Location (Zv9):
Chromosome 5 (position 722668)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150702.1 158980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCTCTGATGGACTGGAGAAAATATTCATTCGCAGAGATCAAGAAGTT[C/T]AGCGTCTGGAACAGGAAGTGCAGAGACTTCAGCGGCGGTTGCAGGAAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link