ENSDARG00000086554

Ensembl ID:
ENSDARG00000086554
Human Orthologue:
PNPLA1
Human Description:
patatin-like phospholipase domain containing 1 [Source:HGNC Symbol;Acc:21246]
Mouse Orthologue:
Pnpla1
Mouse Description:
patatin-like phospholipase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3617850]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37609 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37609
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124604 Essential Splice Site 68 325 1 6
Genomic Location (Zv9):
Chromosome 23 (position 5229104)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 5215904
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCAACTTCATCAGACTGGTGGATGCCATATTCGCTCGAGACTGGAGGG[T/G]GAGTTTGTGTGGAGCTTTTTTAGAGCTTTTACTGTCCACTTGGACGAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link