DBF4B

Ensembl ID:
ENSDARG00000086550
Description:
DBF4 homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:17883]
Human Orthologue:
DBF4B
Human Description:
DBF4 homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:17883]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41983 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41983
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128213 Nonsense 72 831 2 11
Genomic Location (Zv9):
Chromosome 12 (position 15007557)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13863210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTCATAATGATTTGCCTGTGGATAGTTCATGTGCTACAGGGAGAAAA[C/T]AATCTGGAACTTCCAAACCTCTGGTATATACCCATCGTGATCCACAACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link