ENSDARG00000086538

Ensembl ID:
ENSDARG00000086538

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24746 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa39501 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114832 Splice Site, Nonsense 24 201 3 3
Genomic Location (Zv9):
Chromosome Zv9_scaffold3487 (position 217654)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 58807786
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAGTCCAGTTTTAATAAATGGTGTAATGTGTGTTTACTTGCGTTTAGA[T/A]GCCTTTGAGCTCACACTGGATCCAAACACAGTAAATAACGCCCTGGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39501
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114832 Nonsense 173 201 3 3
Genomic Location (Zv9):
Chromosome Zv9_scaffold3487 (position 218100)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 58807340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCTCTCTGTCCTTCTACAGCGTCTCTGACACACACGAACTCACACAAT[T/A]GCACACATTCAACACCATATTCACTGACACACTCTATGCTGGATTTACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link