RELN (2 of 4)

Ensembl ID:
ENSDARG00000086526
Description:
reelin [Source:HGNC Symbol;Acc:9957]
Human Orthologue:
RELN
Human Description:
reelin [Source:HGNC Symbol;Acc:9957]
Mouse Orthologue:
Reln
Mouse Description:
reelin Gene [Source:MGI Symbol;Acc:MGI:103022]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7450 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7450
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122235 Missense 9 160 1 3
Genomic Location (Zv9):
Chromosome 18 (position 49821974)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50887786
KASP Assay ID:
554-4237.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCCGCTATGTGGAGACGCAGTCCATGCAGATCGGAGCCTCCTACATGA[T/A]CCAGTTCCAGCTGGTGATGGGCTGCGGGCGCGAGCCGTCRCCACACATCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link