erlin2

Ensembl ID:
ENSDARG00000086523
ZFIN ID:
ZDB-GENE-090505-4
Description:
Erlin-2 [Source:UniProtKB/Swiss-Prot;Acc:A3QK16]
Human Orthologue:
ERLIN2
Human Description:
ER lipid raft associated 2 [Source:HGNC Symbol;Acc:1356]
Mouse Orthologue:
Erlin2
Mouse Description:
ER lipid raft associated 2 Gene [Source:MGI Symbol;Acc:MGI:2387215]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1659 Nonsense Available for shipment Available now
sa40490 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa1659
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098015 Nonsense 93 331 4 11
ENSDART00000131286 Nonsense 93 331 5 12
ENSDART00000141239 Nonsense 113 235 5 9
Genomic Location:
Chromosome 5 (position 37091087)
KASP Assay ID:
554-1606.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGTGGAGGTGTAATGATCTACTTTGATCGCATTGAGGTGGTGAACTA[C/A]CTTGTTCCCTCAGCAGGTAAAATGATCTATTTGTCATTTATAATGTCGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa40490
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098015 Essential Splice Site 185 331 8 11
ENSDART00000131286 Essential Splice Site 185 331 9 12
ENSDART00000141239 Essential Splice Site 205 235 9 9
Genomic Location:
Chromosome 5 (position 37096220)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTACTTTCCTTTGTTTAATATTTTGTGTGTTTGTTCATGTGTTCCTCA[G/A]GGAGAGTGAGAGAACAAAGTTACTGATTGCAGCTCAGACTCAGAAGGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link