EIF2C4

Ensembl ID:
ENSDARG00000086514
Description:
eukaryotic translation initiation factor 2C, 4 [Source:HGNC Symbol;Acc:18424]
Human Orthologue:
EIF2C4
Human Description:
eukaryotic translation initiation factor 2C, 4 [Source:HGNC Symbol;Acc:18424]
Mouse Orthologue:
Eif2c4
Mouse Description:
eukaryotic translation initiation factor 2C, 4 Gene [Source:MGI Symbol;Acc:MGI:1924100]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23604 Nonsense Mutation detected in F1 DNA During 2014
sa13019 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23604
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129463 Nonsense 799 874 17 18
Genomic Location:
Chromosome 19 (position 49524164)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGGGACGACAACTGTTTCACCGCTGACGAGCTCCAGCTTTTGACCTA[T/A]CAGCTCTGCCACACTTATGTGCGCTGCACCCGCTCCGTCTCCATCCCCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13019
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129463 Nonsense 805 874 17 18
Genomic Location:
Chromosome 19 (position 49524146)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACCGCTGACGAGCTCCAGCTTTTGACCTAYCAGCTCTGCCACACTTA[T/A]GTGCGCTGCACCCGCTCCGTCTCCATCCCCGCSCCAGCTTACTAYGCCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jt97yp4e