EIF2C4

Ensembl ID:
ENSDARG00000086514
Description:
eukaryotic translation initiation factor 2C, 4 [Source:HGNC Symbol;Acc:18424]
Human Orthologue:
EIF2C4
Human Description:
eukaryotic translation initiation factor 2C, 4 [Source:HGNC Symbol;Acc:18424]
Mouse Orthologue:
Eif2c4
Mouse Description:
eukaryotic translation initiation factor 2C, 4 Gene [Source:MGI Symbol;Acc:MGI:1924100]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29273 Essential Splice Site Mutation detected in F1 DNA During 2015
sa23604 Nonsense Mutation detected in F1 DNA During 2015
sa13019 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29273
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129463 Essential Splice Site 7 874 2 18
Genomic Location:
Chromosome 19 (position 49546903)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCTGAACTTCCCCTTTGTCTTTAAACTAATATGTTGTTTCTTCTTCC[A/C]GGCCCGCCTGCCCCTACCTCCCTCTTCCAGCCACCGCGCCGGCCCGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23604
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129463 Nonsense 799 874 17 18
Genomic Location:
Chromosome 19 (position 49524164)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGGGACGACAACTGTTTCACCGCTGACGAGCTCCAGCTTTTGACCTA[T/A]CAGCTCTGCCACACTTATGTGCGCTGCACCCGCTCCGTCTCCATCCCCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13019
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129463 Nonsense 805 874 17 18
Genomic Location:
Chromosome 19 (position 49524146)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACCGCTGACGAGCTCCAGCTTTTGACCTAYCAGCTCTGCCACACTTA[T/A]GTGCGCTGCACCCGCTCCGTCTCCATCCCCGCSCCAGCTTACTAYGCCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jt97yp4e