PRODH (3 of 3)

Ensembl ID:
ENSDARG00000086512
Description:
proline dehydrogenase (oxidase) 1 [Source:HGNC Symbol;Acc:9453]
Human Orthologue:
PRODH
Human Description:
proline dehydrogenase (oxidase) 1 [Source:HGNC Symbol;Acc:9453]
Mouse Orthologue:
Prodh
Mouse Description:
proline dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:97770]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17545 Nonsense Available for shipment Available now
sa26407 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17545
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122084 Nonsense 68 365 3 10
Genomic Location (Zv9):
Chromosome 5 (position 12357659)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 10768834
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTAGCAAGGCTAGGAGCYGAAGGCAACATTCAGAGCTWCTTCTCTGAT[G/T]GACGACTGCACTCATCAGGGTGAGAAACACCGGCTTCCCGTAGCCGTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122084 Essential Splice Site 303 365 9 10
Genomic Location (Zv9):
Chromosome 5 (position 12335257)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 10746432
KASP Assay ID:
2259-5458.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTCGGCCAGCTCCTGGGAATGTGTGACCAAATCAGCTTTCCGTTAGG[T/C]GAACACACACACACCCACACACAGCCACACACACACTCGCTAGAAGTGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link