Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
PTPRJ (3 of 3)
- Ensembl ID:
- ENSDARG00000086511
- Description:
- protein tyrosine phosphatase, receptor type, J [Source:HGNC Symbol;Acc:9673]
- Human Orthologue:
- PTPRJ
- Human Description:
- protein tyrosine phosphatase, receptor type, J [Source:HGNC Symbol;Acc:9673]
- Mouse Orthologue:
- Ptprj
- Mouse Description:
- protein tyrosine phosphatase, receptor type, J Gene [Source:MGI Symbol;Acc:MGI:104574]
Alleles
There are 3 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa30262 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa38078 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa44309 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa30262
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000124237 | Nonsense | 22 | 1271 | 1 | 24 |
- Genomic Location (Zv9):
- Chromosome 25 (position 24042658)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 23221771 GRCz11 25 23319319 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGAAATCTTACTGTGGCCAACATCACAACATCATCTGCTTTTCTGAAAT[G/A]GGATGAACCTCAGGGGAATAGATCTTTCTTTAAAATTCAGTGGAGTGATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38078
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000124237 | Essential Splice Site | 88 | 1271 | 2 | 24 |
- Genomic Location (Zv9):
- Chromosome 25 (position 24042970)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 23222083 GRCz11 25 23319631 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTTTTTATTAAGAGTTATAATCTCCAAATGTCTTTTATCATTCATTCAC[A/T]GAGCCTGGTGTTATAATGAACCTCAAAGCTGATAATATCACCACATCATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44309
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000124237 | Nonsense | 1011 | 1271 | 17 | 24 |
- Genomic Location (Zv9):
- Chromosome 25 (position 24060657)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 23239770 GRCz11 25 23337318 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGCCGCCCTGGCTCTTGAAAACAAGGAGAAGAATCGTTACTTAAATGTTT[T/A]ACCTTGTGAGTATCTTCACTGTTGTGTATTGTAAAAAAAAAGTGTCAGTA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Acute lymphoblastic leukemia (childhood): Identification of germline susceptibility loci in ETV6-RUNX1-rearranged childhood acute lymphoblastic leukemia. (View Study)
- D-dimer levels: Genetic predictors of fibrin D-dimer levels in healthy adults. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
