PTPRJ (3 of 3)

Ensembl ID:
ENSDARG00000086511
Description:
protein tyrosine phosphatase, receptor type, J [Source:HGNC Symbol;Acc:9673]
Human Orthologue:
PTPRJ
Human Description:
protein tyrosine phosphatase, receptor type, J [Source:HGNC Symbol;Acc:9673]
Mouse Orthologue:
Ptprj
Mouse Description:
protein tyrosine phosphatase, receptor type, J Gene [Source:MGI Symbol;Acc:MGI:104574]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30262 Nonsense Mutation detected in F1 DNA During 2017
sa38078 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44309 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30262
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124237 Nonsense 22 1271 1 24
Genomic Location (Zv9):
Chromosome 25 (position 24042658)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23221771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAATCTTACTGTGGCCAACATCACAACATCATCTGCTTTTCTGAAAT[G/A]GGATGAACCTCAGGGGAATAGATCTTTCTTTAAAATTCAGTGGAGTGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38078
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124237 Essential Splice Site 88 1271 2 24
Genomic Location (Zv9):
Chromosome 25 (position 24042970)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23222083
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTTTATTAAGAGTTATAATCTCCAAATGTCTTTTATCATTCATTCAC[A/T]GAGCCTGGTGTTATAATGAACCTCAAAGCTGATAATATCACCACATCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44309
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124237 Nonsense 1011 1271 17 24
Genomic Location (Zv9):
Chromosome 25 (position 24060657)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23239770
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCGCCCTGGCTCTTGAAAACAAGGAGAAGAATCGTTACTTAAATGTTT[T/A]ACCTTGTGAGTATCTTCACTGTTGTGTATTGTAAAAAAAAAGTGTCAGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link