MAST3 (1 of 2)

Ensembl ID:
ENSDARG00000086505
Description:
microtubule associated serine/threonine kinase 3 [Source:HGNC Symbol;Acc:19036]
Human Orthologue:
MAST3
Human Description:
microtubule associated serine/threonine kinase 3 [Source:HGNC Symbol;Acc:19036]
Mouse Orthologue:
Mast3
Mouse Description:
microtubule associated serine/threonine kinase 3 Gene [Source:MGI Symbol;Acc:MGI:2683541]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21868 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17432 Nonsense Available for shipment Available now
sa41798 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa21868
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121872 Essential Splice Site 108 1433 4 26
Genomic Location (Zv9):
Chromosome 11 (position 13519135)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13275958
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTCCATCCTCAGGTTACGGGACCAATCCTCCCAGCTCAACAGTCTCAG[T/A]ATGTGCCTCAGTATGAATCAACAATTCCTTCTTACAAAACTGTTCTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17432
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121872 Nonsense 854 1433 21 26
Genomic Location (Zv9):
Chromosome 11 (position 13478021)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13234844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGGGGTCCTCCATGCTTTGGAAACCAGCTGGAGACACCCGACAAACAG[C/T]GACTCTCACCAGGACGCAAAGTCCCCAAATCCGCATCAGTRTCCACTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41798
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121872 Nonsense 938 1433 22 26
Genomic Location (Zv9):
Chromosome 11 (position 13477536)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13234359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGCTCTGGGAAGAAATTTGGCTTCACGCTACAGACTATTCGTGTTTA[C/A]ATGGGGAACAGTGACATCTACACCATACACCACATGGTCTCGGTGAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link