MAST3 (1 of 2)

Ensembl ID:
ENSDARG00000086505
Description:
microtubule associated serine/threonine kinase 3 [Source:HGNC Symbol;Acc:19036]
Human Orthologue:
MAST3
Human Description:
microtubule associated serine/threonine kinase 3 [Source:HGNC Symbol;Acc:19036]
Mouse Orthologue:
Mast3
Mouse Description:
microtubule associated serine/threonine kinase 3 Gene [Source:MGI Symbol;Acc:MGI:2683541]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21868 Essential Splice Site Mutation detected in F1 DNA During 2014
sa17432 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21868
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121872 Essential Splice Site 108 1433 4 26
Genomic Location:
Chromosome 11 (position 13519135)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTCCATCCTCAGGTTACGGGACCAATCCTCCCAGCTCAACAGTCTCAG[T/A]ATGTGCCTCAGTATGAATCAACAATTCCTTCTTACAAAACTGTTCTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17432
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121872 Nonsense 854 1433 21 26
Genomic Location:
Chromosome 11 (position 13478021)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGGGGTCCTCCATGCTTTGGAAACCAGCTGGAGACACCCGACAAACAG[C/T]GACTCTCACCAGGACGCAAAGTCCCCAAATCCGCATCAGTRTCCACTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0kyidrte