ENSDARG00000086498

Ensembl ID:
ENSDARG00000086498
Human Orthologues:
CLCA1, CLCA2, CLCA4
Human Descriptions:
chloride channel accessory 1 [Source:HGNC Symbol;Acc:2015]
chloride channel accessory 2 [Source:HGNC Symbol;Acc:2016]
chloride channel accessory 4 [Source:HGNC Symbol;Acc:2018]
Mouse Orthologues:
AI747448, Clca1, Clca2, Clca3, Clca4, Clca5, Clca6, Gm6289
Mouse Descriptions:
chloride channel calcium activated 1 Gene [Source:MGI Symbol;Acc:MGI:1316732]
chloride channel calcium activated 2 Gene [Source:MGI Symbol;Acc:MGI:1931471]
chloride channel calcium activated 3 Gene [Source:MGI Symbol;Acc:MGI:1346342]
chloride channel calcium activated 4 Gene [Source:MGI Symbol;Acc:MGI:2181989]
chloride channel calcium activated 5 Gene [Source:MGI Symbol;Acc:MGI:2139758]
chloride channel calcium activated 6 Gene [Source:MGI Symbol;Acc:MGI:2139744]
expressed sequence AI747448 Gene [Source:MGI Symbol;Acc:MGI:2139790]
predicted gene 6289 Gene [Source:MGI Symbol;Acc:MGI:3643218]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32022 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32022
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125095 Nonsense 98 229 3 5
Genomic Location (Zv9):
Chromosome 15 (position 14178566)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14209614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATTTTCATTCATTTTATTTACATCAGATAATTCTGTTAATTGCAGGCC[A/T]AAATAAGAATCGATAGTCCTCATCCAGCATATGGTGATGAACCGTACACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link