ENSDARG00000086485

Ensembl ID:
ENSDARG00000086485

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12541 Nonsense Available for shipment Available now
sa19074 Nonsense Mutation detected in F1 DNA During 2014
sa13087 Nonsense Available for shipment Available now
sa12552 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12541
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
Genomic Location:
Chromosome 14 (position 2651176)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAATTTTACAAAAGGCTTTAGACCGAGAGGTTATTCGAAACTWTGATT[T/A]GCAATTGATTGCAGWAGATGGCGGAAAACCTGCCAAATCAGGCACAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19074
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
Genomic Location:
Chromosome 14 (position 2651176)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAATTTTACAAAAGGCTTTAGACCGAGAGGTTATTCGAAACTTTGATT[T/A]GCAATTGATTGCAGTAGATGGCGGAAAACCTGCCAAATCAGGCACAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13087
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
Genomic Location:
Chromosome 14 (position 2651176)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAATTTTACAAAAGGCTTTAGACCGAGAGGTTATTCGAAACTWTGATT[T/A]GCAATTGATTGCAGWAGATGGCGGAAAACCTGCCAAATCAGGCACAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
ENSDART00000127511 Nonsense 182 758 1 1
Genomic Location:
Chromosome 14 (position 2651176)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAATTTTACAAAAGGCTTTAGACCGAGAGGTTATTCGAAACTWTGATT[T/A]GCAATTGATTGCAGWAGATGGCGGAAAACCTGCCAAATCAGGCACAATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6y4yjgto