LOC563998

Ensembl ID:
ENSDARG00000086484
Human Orthologues:
AC005838.1, AC005838.2, CDRT1, FBXW10
Human Descriptions:
CMT duplicated region transcript 1 [Source:UniProtKB/TrEMBL;Acc:Q9BXD7]
CMT1A duplicated region transcript 1 protein [Source:UniProtKB/Swiss-Prot;Acc:O95170]
CMT1A duplicated region transcript 1 [Source:HGNC Symbol;Acc:14379]
F-box and WD repeat domain containing 10 [Source:HGNC Symbol;Acc:1211]
Mouse Orthologue:
Fbxw10
Mouse Description:
F-box and WD-40 domain protein 10 Gene [Source:MGI Symbol;Acc:MGI:3052463]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5855 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22156 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5855
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123825 Essential Splice Site 191 731 5 12
Genomic Location:
Chromosome 12 (position 37132559)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAAGAGAAAGACCTGGTTATCAGCGCCAGCTATGATCTCAGTATCAGG[T/C]TAGTCAGACATTATTATGCTGTTTCAAAAATTAAGATGATAGATCACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22156
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123825 Essential Splice Site 191 731 6 12
Genomic Location:
Chromosome 12 (position 37131881)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTGTTGGCAATAAAGAATATTGTGCTTTAATTCTCTACTGCTTTTGA[A/G]GGTGCTGGAACCTGAAAACAGGCATGTGTATGATGATTTTTCATGGACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w9rgakqs