LOC563998

Ensembl ID:
ENSDARG00000086484
Human Orthologues:
AC005838.1, AC005838.2, CDRT1, FBXW10
Human Descriptions:
CMT duplicated region transcript 1 [Source:UniProtKB/TrEMBL;Acc:Q9BXD7]
CMT1A duplicated region transcript 1 protein [Source:UniProtKB/Swiss-Prot;Acc:O95170]
CMT1A duplicated region transcript 1 [Source:HGNC Symbol;Acc:14379]
F-box and WD repeat domain containing 10 [Source:HGNC Symbol;Acc:1211]
Mouse Orthologue:
Fbxw10
Mouse Description:
F-box and WD-40 domain protein 10 Gene [Source:MGI Symbol;Acc:MGI:3052463]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35354 Essential Splice Site Mutation detected in F1 DNA During 2016
sa5855 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22156 Essential Splice Site Available for shipment Available now
sa27996 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42080 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35354
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123825 Essential Splice Site 123 731 4 12
Genomic Location (Zv9):
Chromosome 12 (position 37133123)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35853345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACGCAATGTATACTGTGGAGTGTATAACACCTCTGTCCTGTTAGAAAG[G/A]TAGAATTTCTTTTAAGAACTTGGTAGAATGTACGATAGCAAAATTACTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5855
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123825 Essential Splice Site 191 731 5 12
Genomic Location (Zv9):
Chromosome 12 (position 37132559)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35853909
KASP Assay ID:
554-3662.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAAGAGAAAGACCTGGTTATCAGCGCCAGCTATGATCTCAGTATCAGG[T/C]TAGTCAGACATTATTATGCTGTTTCAAAAATTAAGATGATAGATCACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22156
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123825 Essential Splice Site 191 731 6 12
Genomic Location (Zv9):
Chromosome 12 (position 37131881)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35854587
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTGTTGGCAATAAAGAATATTGTGCTTTAATTCTCTACTGCTTTTGA[A/G]GGTGCTGGAACCTGAAAACAGGCATGTGTATGATGATTTTTCATGGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123825 Essential Splice Site 232 731 6 12
Genomic Location (Zv9):
Chromosome 12 (position 37131756)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35854712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGTTGGAGATAGGCTGGTCTCTGGAGCCAAAGACTGTAGAGTTAAAGG[T/G]AAGTGGCTTTGATTTGAATGATGCTTTTTACAGGAAATTCACACCAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123825 Nonsense 334 731 9 12
Genomic Location (Zv9):
Chromosome 12 (position 37130378)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35856090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTAATATAGTTAATAATTATGCCTCTATTATGATTCTTAGAGAGGTGT[T/A]GGCAATGTCTTTTCTGTTCCTGCGAATCATTACCGGTTGCATGGATGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link