SF1

Ensembl ID:
ENSDARG00000086479
Description:
splicing factor 1 [Source:HGNC Symbol;Acc:12950]
Human Orthologues:
KHDRBS3, SF1
Human Descriptions:
KH domain containing, RNA binding, signal transduction associated 3 [Source:HGNC Symbol;Acc:18117]
splicing factor 1 [Source:HGNC Symbol;Acc:12950]
Mouse Orthologue:
Khdrbs3
Mouse Description:
KH domain containing, RNA binding, signal transduction associated 3 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12636 Essential Splice Site Available for shipment Available now
sa34782 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12636
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125996 Essential Splice Site 63 247 2 7
Genomic Location (Zv9):
Chromosome 9 (position 54510497)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149702.1 84869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTAGAATGGGCCACGCTTTGGAGGAGATCAAAAAGTTCCTSATTCCGG[T/G]ACGWCTGTGCTGKTAWTACAGTGTCAGTGTGTTATTWCAGTATGCAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34782
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125996 Splice Site, Nonsense 172 247 4 7
Genomic Location (Zv9):
Chromosome 9 (position 54514816)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149702.1 80550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGGATACAGGCCTCCCCCTGCTGTTGTGCAGGACACATATGGAGAATA[T/A]GTGAGTAGCTCAAACATCTCTTTCTGTAGGTGGCACTCTAAGACGTTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Urate levels: Genome-wide association study for serum urate concentrations and gout among African Americans identifies genomic risk loci and a novel URAT1 loss-of-function allele. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link