LOC100001594

Ensembl ID:
ENSDARG00000086477

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1074 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa1074
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124096 Nonsense 191 223 3 3
Genomic Location:
Chromosome 22 (position 5805265)
KASP Assay ID:
554-0976.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTATTGTCCAGAATCAGAGTGTCGGGGCACAAAATCAGTCTCTTTTTA[C/T]AACTGGACTGTCTAAAYGGTTCTTACAGCTGTGTGGTGGCTTATTCATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r3gu6a5t