CLPX (2 of 3)

Ensembl ID:
ENSDARG00000086455
Description:
ClpX caseinolytic peptidase X homolog (E. coli) [Source:HGNC Symbol;Acc:2088]
Human Orthologue:
CLPX
Human Description:
ClpX caseinolytic peptidase X homolog (E. coli) [Source:HGNC Symbol;Acc:2088]
Mouse Orthologue:
Clpx
Mouse Description:
caseinolytic peptidase X (E.coli) Gene [Source:MGI Symbol;Acc:MGI:1346017]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5399 Nonsense Mutation detected in F1 DNA During 2014
sa18864 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15422 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124966 Nonsense 2 224 1 5
Genomic Location:
Chromosome 7 (position 14467055)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATTCAACCGGTTCAGTTCGTTAAAAACACACAACAGCACTGAAAATGT[C/A]GTGCACGTGTGCTATAGCAGCGAGAAAATTCATAAATTCAGCTCATAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18864
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124966 Essential Splice Site 109 224 3 5
Genomic Location:
Chromosome 7 (position 14471709)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGCCCCAAATGCGGAGATCCCTGCACACATGTAGAAACATTTGTTTG[T/C]GAGTACTTGAATTACTTGTAGTTAACTTTGTATCATCCATTTTTAATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124966 Nonsense 164 224 5 5
Genomic Location:
Chromosome 7 (position 14473714)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTASGTTGTAACGTCTCCGCTTTTGTTTTCTYSCAGATCTTTGCTTA[T/A]CTTGATAAGTWTGTTGTGGGTCAGGACCATRCTAAGAAGGTATTGTCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cofd2hdi