si:dkey-157e10.5

Ensembl ID:
ENSDARG00000086454
ZFIN ID:
ZDB-GENE-070705-299
Description:
Novel NACHT domain containing protein [Source:UniProtKB/TrEMBL;Acc:B0S6Q7]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25284 Missense, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25284
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123370 Nonsense 4 852 1 13
ENSDART00000125460 Missense 267 909 1 7
ENSDART00000143586 Missense 278 649 1 1
Genomic Location (Zv9):
Chromosome 4 (position 44518217)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 53296594
KASP Assay ID:
554-7848.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATACATCAAGCGTCTGACAGAAATTCAGGGATTTACTGAGCCTCAGAA[G/T]GAGGAATATTTCAGGAAGAGAATCAGCGATGAGCATCGAGCCAGCAGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link