DTHD1

Ensembl ID:
ENSDARG00000086452
Description:
death domain containing 1 [Source:HGNC Symbol;Acc:37261]
Human Orthologue:
DTHD1
Human Description:
death domain containing 1 [Source:HGNC Symbol;Acc:37261]
Mouse Orthologue:
AC122231.1
Mouse Description:
death domain containing 1 [Source:RefSeq peptide;Acc:NP_001164176]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21063 Nonsense Available for shipment Available now
sa21064 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21063
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123868 Nonsense 168 589 3 8
Genomic Location (Zv9):
Chromosome 7 (position 52263028)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50532778
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTCAGGTACAGCCAGTGGATGCCTTTATTTTATCATCTCTAAAATCC[A/T]AAAATGATTCTTATCGTGAAGCTCTTACCTCAACCCCCCTGCTTTACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21064
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123868 Nonsense 575 589 8 8
Genomic Location (Zv9):
Chromosome 7 (position 52273740)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50543490
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGACCTGACCTCGCCAACCAACTACTGCTCAAAGGAGCTGCAAATCAC[C/T]AAGTGGAGGAAAAACATGAAGATCAGACCAGCAGGAGAAATCTGTGAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link