LOC558951

Ensembl ID:
ENSDARG00000086450
Human Orthologue:
TDG
Human Description:
thymine-DNA glycosylase [Source:HGNC Symbol;Acc:11700]
Mouse Orthologues:
Gm5806, Tdg
Mouse Descriptions:
predicted gene 5806 Gene [Source:MGI Symbol;Acc:MGI:3645587]
thymine DNA glycosylase Gene [Source:MGI Symbol;Acc:MGI:108247]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39480 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39481 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39480
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123207 Essential Splice Site 79 400 2 10
Genomic Location (Zv9):
Chromosome 25 (position 19445434)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18857411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATCAAGATCAACCTCAACAGTTTCAACAGCTCCCTGTCCAACCACCAG[G/A]TGCGACTTTTTTCTCCTTACAATATATCTAGAGATATTTCTTCAGTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39481
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123207 Essential Splice Site 331 400 9 10
Genomic Location (Zv9):
Chromosome 25 (position 19449475)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18861452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTTTTATTAATGTGCTAACGAAATTTATTTTCATTGTTTATTTT[A/T]GAGGATGCCAAAAGAATGGCAATCAAAGAAGAGCAGAATGACCCTGGGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link